Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08529

HP ID(1) HP08529
Gene ID(2) 51174
Gene Symbol finder TUBD1
Protein Name tubulin, delta 1
RefSeq NM_016261.2
Length of RefSeq (bp) 2472
Chromosome 17q23.1
Reference DDBJ accession
UniGene Hs.463638

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd60H10 pGCAP10 GAGTGAGCATGCGTACCATATCTGAAGTTCGTAAATTGAAATTGAACATGCGTAATTAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl