Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08523

HP ID(1) HP08523
Gene ID(2) 23032
Gene Symbol finder USP33
Protein Name ubiquitin specific peptidase 33
RefSeq NM_015017.3
Length of RefSeq (bp) 4524
Chromosome 1p31.1
Reference DDBJ accession
UniGene Hs.719202

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd59H11 pGCAP10 GGCGGAGGTGCGGCTGCAGGCCGTTGTTGGTCGAGCTGGCGGGTCCCGCGGGCCAGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl