Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08441

HP ID(1) HP08441
Gene ID(2) 55435
Gene Symbol finder C4orf16
Protein Name chromosome 4 open reading frame 16
RefSeq NM_018569.3
Length of RefSeq (bp) 2831
Chromosome 4q25
Reference DDBJ accession
UniGene Hs.435991

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd48C07 pGCAP10 GAGGAGCTGAGGCGAGAAGGGCCATGCGGACGGCGAGGGAGTCCAGAGCCTTGAGCCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl