Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08247

HP ID(1) HP08247
Gene ID(2) 92106
Gene Symbol finder OXNAD1
Protein Name oxidoreductase NAD-binding domain containing 1
RefSeq NM_138381.2
Length of RefSeq (bp) 3945
Chromosome 3p25-p24
Reference DDBJ accession
UniGene Hs.475602

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS198H08 pGCAP10 GAAACGTGGCCGGGTCTGCAAGCTAGGTGCCAGCGGGGAAAGTTTCCCTGCTTCTTATCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl