Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08212

HP ID(1) HP08212
Gene ID(2) 90326
Gene Symbol finder THAP3
Protein Name THAP domain containing, apoptosis associated protein 3
RefSeq NM_138350.2
Length of RefSeq (bp) 2052
Chromosome 1p36.31
Reference DDBJ accession
UniGene Hs.702257

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191P14 pGCAP10 GGTTGGGGGCAGCCAGGCCTGGCTCGAGATGCCGAAGTCGTGCGCGGCCCGGCAGTGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl