Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08208

HP ID(1) HP08208
Gene ID(2) 8605
Gene Symbol finder PLA2G4C
Protein Name phospholipase A2, group IVC (cytosolic, calcium-independent)
RefSeq NM_003706.1
Length of RefSeq (bp) 2494
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.631562

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191M12 pGCAP10 GAAGCCGANGAGGGCTGTTTAAAGGCGCAGGGGCCATTTTACCCTCCAGGTTGGCCCTGC
RBdS187F08 pGCAP10 GACCGGATTCAAGTCNAACNCNNCGGCAGGNCTGAACGCTNNNNTAGGNNANNTGCGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl