Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08187

HP ID(1) HP08187
Gene ID(2) 163590
Gene Symbol finder TOR1AIP2
Protein Name torsin A interacting protein 2
RefSeq NM_145034.2
Length of RefSeq (bp) 3073
Chromosome 1q25.2
Reference DDBJ accession
UniGene Hs.693681

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191C16 pGCAP10 GATTCGGGCCGCGGCGGCCGCTGGGTGCAGCCGAGCGGTGTGGAGCGGAGAGAATACTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl