Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08183

HP ID(1) HP08183
Gene ID(2) 80745
Gene Symbol finder THUMPD2
Protein Name THUMP domain containing 2
RefSeq NM_025264.3
Length of RefSeq (bp) 1959
Chromosome 2p22.1; 2p22-p21
Reference DDBJ accession
UniGene Hs.468254

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191A08 pGCAP10 GGAGCCGCCATGTCGGAGGCGCGTGGAGAGCCAGGGTCCGGGCCTGAGGCTGGCGCCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl