Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08168

HP ID(1) HP08168
Gene ID(2) 493911
Gene Symbol finder PHOSPHO2
Protein Name phosphatase, orphan 2
RefSeq NM_001008489.2
Length of RefSeq (bp) 1138
Chromosome 2q31.1
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161J07 pGCAP10 GGGAACAAGGGAGGTGCTGCAGTTGGCGGTCGGGCTAGAGAAGAGAGGCGCCTGCGCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl