Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08161

HP ID(1) HP08161
Gene ID(2) 80023
Gene Symbol finder NRSN2
Protein Name neurensin 2
RefSeq NM_024958.2
Length of RefSeq (bp) 2402
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.416024

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161F02 pGCAP10 GGAAGAGGGCGGGGGCCCGGCGAGGAGAAGCGGTTTCTACGCTGGGGTGGGGCTCCATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl