Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08160

HP ID(1) HP08160
Gene ID(2) 8554
Gene Symbol finder PIAS1
Protein Name protein inhibitor of activated STAT, 1
RefSeq NM_016166.1
Length of RefSeq (bp) 2309
Chromosome 15q
Reference DDBJ accession
UniGene Hs.162458

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161E24 pGCAP10 GGACAGACGCAAGATGGCGGACAGTGCGGAACTAAAGCAAATGGTTATGAGCCTTAGAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl