Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08158

HP ID(1) HP08158
Gene ID(2) 10026
Gene Symbol finder PIGK
Protein Name phosphatidylinositol glycan anchor biosynthesis, class K
RefSeq NM_005482.2
Length of RefSeq (bp) 4626
Chromosome 1p31.1
Reference DDBJ accession
UniGene Hs.178305

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS161D15 pGCAP10 CGGCCGGCCGATGAGGTGCGGGAAGTCTGAAGCCGGTAAACATGGCCGTCACCGACAGCC
ARiS194E19 pGCAP10 GGAGGTGCGGGAAGTCTGAAGCCGGTAAACATGGCCGTCACCGACAGCCTCAGCCGGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl