Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08138

HP ID(1) HP08138
Gene ID(2) 65987
Gene Symbol finder KCTD14
Protein Name potassium channel tetramerisation domain containing 14
RefSeq NM_023930.3
Length of RefSeq (bp) 1688
Chromosome 11q14.1
Reference DDBJ accession
UniGene Hs.709780

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150G22 pGCAP10 GATCTGCATGTGGCAGGGCTGCGCAGTGGAGCGGCCAGTGGGCAGGATGACGAGCCAGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl