Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08135

HP ID(1) HP08135
Gene ID(2) 10100
Gene Symbol finder TSPAN2
Protein Name tetraspanin 2
RefSeq NM_005725.3
Length of RefSeq (bp) 3207
Chromosome 1p13.2
Reference DDBJ accession
UniGene Hs.310458

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150G04 pGCAP10 TGGGCCGGAGCCTGCCGCTCCCCGCGCTCGTAGCGCGGGCCTGGGGACTGGGGATCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl