Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08124

HP ID(1) HP08124
Gene ID(2) 8711
Gene Symbol finder TNK1
Protein Name tyrosine kinase, non-receptor, 1
RefSeq NM_003985.3
Length of RefSeq (bp) 2835
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.203420

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150A10 pGCAP10 GGCAGTCGCCGCTTCCGCCTTGACCAGGTGGAGCTGGAGACCTGGTCTCTCTAGGGCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl