Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08120

HP ID(1) HP08120
Gene ID(2) 5634
Gene Symbol finder PRPS2
Protein Name phosphoribosyl pyrophosphate synthetase 2
RefSeq NM_001039091.1
Length of RefSeq (bp) 2518
Chromosome Xp22.3-p22.2
Reference DDBJ accession
UniGene Hs.654581

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122O09 pGCAP10 GGCAGCAGCAGCCTCCCGCGTCGCTGTCGCTGTTGCCTCCGCCACCTCCTCCGCCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl