Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08112

HP ID(1) HP08112
Gene ID(2) 5303
Gene Symbol finder PIN4
Protein Name protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)
RefSeq NM_006223.2
Length of RefSeq (bp) 1088
Chromosome Xq13
Reference DDBJ accession
UniGene Hs.655623

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122H17 pGCAP10 AGTTCAGAGTTCAACAACAAGCTTCCAAGATGCCGCCCAAAGGAAAAAGTGGTTCTGGAA
RBd85B01 pGCAP10 GAGAGTTCAACAACAAGCTTCCAAGATGCCGCCCAAAGGAAAAAGTGGTTCTGGAAAAGC
RBd98F07 pGCAP10 GAGTTCAGAGTTCAACAACAAGCTTCCAAGATGCCGCCCAAAGGAAAAAGTGGTTCTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl