Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08099

HP ID(1) HP08099
Gene ID(2) 54662
Gene Symbol finder TBC1D13
Protein Name TBC1 domain family, member 13
RefSeq NM_018201.2
Length of RefSeq (bp) 3807
Chromosome 9q34.11
Reference DDBJ accession
UniGene Hs.3376

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122A18 pGCAP10 GGTCCCTGGGGGGCGGCGGCGGCGGCGGCAGCGCAGGCGGCAGAGGCGCAGGCGGCGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl