Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08093

HP ID(1) HP08093
Gene ID(2) 23363
Gene Symbol finder OBSL1
Protein Name obscurin-like 1
RefSeq NM_015311.1
Length of RefSeq (bp) 5841
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.526594

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118M16 pGCAP10 TTGGGGCCCGGGAATCGCCGCCGCCGCCGCCGCAGAGCTGCAGCTCGGGGCCGAGGGTAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl