Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08078

HP ID(1) HP08078
Gene ID(2) 5163
Gene Symbol finder PDK1
Protein Name pyruvate dehydrogenase kinase, isozyme 1
RefSeq NM_002610.3
Length of RefSeq (bp) 4576
Chromosome 2q31.1
Reference DDBJ accession
UniGene Hs.470633

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118E01 pGCAP10 GGGCTTCTCTAGCGGGACTCGGCATGAGGCTGGCGCGGCTGCTTCGCGGAGCCGCCTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl