Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08076

HP ID(1) HP08076
Gene ID(2) 128989
Gene Symbol finder C22orf25
Protein Name chromosome 22 open reading frame 25
RefSeq NM_152906.4
Length of RefSeq (bp) 2271
Chromosome 22q11.21
Reference DDBJ accession
UniGene Hs.474233

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118D12 pGCAP10 GGAAGTCGGCGGCGGTGGCGGAGGCGGTGAGTGCGCGGCTCCGGGGCTGGCCGACTCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl