Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08075

HP ID(1) HP08075
Gene ID(2) 55732
Gene Symbol finder C1orf112
Protein Name chromosome 1 open reading frame 112
RefSeq NM_018186.2
Length of RefSeq (bp) 3363
Chromosome 1q24.2
Reference DDBJ accession
UniGene Hs.443551

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118C23 pGCAP10 AACCANTAANGCCAGAGGACTGNCNNNCCAAAATTTGGAAATCCAGACCNCTCNNAGGAA
RBdS014P21 pGCAP10 GGTTTTGAAGCTCTCCTGTTTGACGAAAGTATGTCTCAGGAAGGTGCGGTCCCAGCTAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl