Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08048

HP ID(1) HP08048
Gene ID(2) 388969
Gene Symbol finder C2orf68
Protein Name chromosome 2 open reading frame 68
RefSeq NM_001013649.3
Length of RefSeq (bp) 4283
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.516159

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd92G05 pGCAP10 GGTTGTTGGGGCCGTCGAGGCGGCGGCGACTCTGCGTCCCCGGCTCCTGATGGAGGCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl