Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08044

HP ID(1) HP08044
Gene ID(2) 55254
Gene Symbol finder TMEM39A
Protein Name transmembrane protein 39A
RefSeq NM_018266.1
Length of RefSeq (bp) 2957
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.656003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096B07 pGCAP10 AGCTCCGCGGTAATGGAGGCTAGGGATGGGTGCTGAAGTATCAGGCTCTGGCTCTAGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl