Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08034

HP ID(1) HP08034
Gene ID(2) 9791
Gene Symbol finder PTDSS1
Protein Name phosphatidylserine synthase 1
RefSeq NM_014754.1
Length of RefSeq (bp) 2504
Chromosome 8q22
Reference DDBJ accession
UniGene Hs.292579

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088K24 pGCAP10 GCCTTCCCTCTGCTCCCAGCCTTTGCTGGGCGCCAGACCCGGCTTTGCCGTCCGGCTATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl