Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08022

HP ID(1) HP08022
Gene ID(2) 8741
Gene Symbol finder TNFSF13
Protein Name tumor necrosis factor (ligand) superfamily, member 13
RefSeq NM_003808.3
Length of RefSeq (bp) 2293
Chromosome 17p13.1
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088F08 pGCAP10 GCTCTTCGTCCAGAGCCTTATGTAAGAGCTTTTCTCGGGAAACAGGAAGTCCTGCTTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl