Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07989

HP ID(1) HP07989
Gene ID(2) 55076
Gene Symbol finder TMEM45A
Protein Name transmembrane protein 45A
RefSeq NM_018004.1
Length of RefSeq (bp) 1564
Chromosome 3q12.2
Reference DDBJ accession
UniGene Hs.658956

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085O07 pGCAP10 GGCCACTTATTATTTATTCGTTTTCCCAAAGAAGCGACTAGGGACCCAAGTTTAAAAATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl