Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07974

HP ID(1) HP07974
Gene ID(2) 4928
Gene Symbol finder NUP98
Protein Name nucleoporin 98kDa
RefSeq NM_016320.3
Length of RefSeq (bp) 6850
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.524750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085G20 pGCAP10 GCCTCTGCGCGCTGCGCCCGAAGCGGCGGTCGGTGGCAGGGGTGGTAGCGGCGGCGGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl