Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07970

HP ID(1) HP07970
Gene ID(2) 64146
Gene Symbol finder PDF
Protein Name peptide deformylase (mitochondrial)
RefSeq NM_022341.1
Length of RefSeq (bp) 1180
Chromosome 16q22.1
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085E08 pGCAP10 GGCCGCCATGGCCCGGCTGTGGGGCGCGCTGAGTCTTTGGCCACTGTGGGCGGCCGTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl