Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07961

HP ID(1) HP07961
Gene ID(2) 123016
Gene Symbol finder TTC8
Protein Name tetratricopeptide repeat domain 8
RefSeq NM_198310.2
Length of RefSeq (bp) 2128
Chromosome 14q31.3
Reference DDBJ accession
UniGene Hs.303055

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055P15 pGCAP10 GCTTCGCTGGCCGCACCGGCAGCCATGAGCTCGGAGATGGAGCCGCTGCTCCTGGCCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl