Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07942

HP ID(1) HP07942
Gene ID(2) 4905
Gene Symbol finder NSF
Protein Name N-ethylmaleimide-sensitive factor
RefSeq NM_006178.2
Length of RefSeq (bp) 3983
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.431279

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049L13 pGCAP10 GGCAGAGCTGCAGCCGCCGAGCCGGACGTGTCCGCGAAGATGGCGGGCCGGAGCATGCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl