Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07876

HP ID(1) HP07876
Gene ID(2) 22981
Gene Symbol finder NINL
Protein Name ninein-like
RefSeq NM_025176.4
Length of RefSeq (bp) 4979
Chromosome 20p11.22-p11.1
Reference DDBJ accession
UniGene Hs.631508

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd41E08 pGCAP10 GACAAAGAGCGGCCGGCGGTACGGGGGTGGTGCCGCGCTCCTGGCCCCGCGCGGGCGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl