Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07874

HP ID(1) HP07874
Gene ID(2) 114825
Gene Symbol finder PWWP2A
Protein Name PWWP domain containing 2A
RefSeq NM_052927.2
Length of RefSeq (bp) 4016
Chromosome 5q33.3
Reference DDBJ accession
UniGene Hs.699426

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd41A08 pGCAP10 TGGAAGCTAGGAAGAAAATGGCGGCCGTGGCTGCAGAGGCGGCAGCGACTGCAGCGTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl