Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07867

HP ID(1) HP07867
Gene ID(2) 25989
Gene Symbol finder ULK3
Protein Name unc-51-like kinase 3 (C. elegans)
RefSeq NM_001099436.1
Length of RefSeq (bp) 2635
Chromosome 15q24.1
Reference DDBJ accession
UniGene Hs.513034

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd40E09 pGCAP10 GGCGCGGGCGCAGGCGGCCGGAATGGCGGGGCCCGGCTGGGGTCCCCCGCGCCTGGACGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl