Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07842

HP ID(1) HP07842
Gene ID(2)
Gene Symbol finder NR2C2(intron1, opposite)
Protein Name CDNA clone IMAGE:4827685
RefSeq
Length of RefSeq (bp) 1199
Chromosome 3p25.1
Reference DDBJ accession BC033386.1
UniGene Hs.707663

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd38C11 pGCAP10 GACCCTCCCCTTCAGAAAAAACGGCGGTTGGGCTGCGACGGCCGCCAAAGGCGGACTAGA
RBd70E06 pGCAP10 GACCCCCACCCTTGCGCCGGCCGGGCCGGTCAGGGGGAACCCGCTCGCTTCGCCCGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl