Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07832

HP ID(1) HP07832
Gene ID(2) 55229
Gene Symbol finder PANK4
Protein Name pantothenate kinase 4
RefSeq NM_018216.1
Length of RefSeq (bp) 2642
Chromosome 1p36.32
Reference DDBJ accession
UniGene Hs.26156

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd37A10 pGCAP10 GACTTTCAAAATGGCGGAGTGTGGAGCGAGCGGCAGCGGGAGCAGCGGGGACAGTCTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl