Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07813

HP ID(1) HP07813
Gene ID(2) 5635
Gene Symbol finder PRPSAP1
Protein Name phosphoribosyl pyrophosphate synthetase-associated protein 1
RefSeq NM_002766.2
Length of RefSeq (bp) 2359
Chromosome 17q24-q25
Reference DDBJ accession
UniGene Hs.77498

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd35D08 pGCAP10 GGGGGGCGGTGGCCTTGCCTCTGGCTCTGAGGCGGCGGCGCCGGGCGCTGCGAAGGCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl