Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07799

HP ID(1) HP07799
Gene ID(2) 5291
Gene Symbol finder PIK3CB
Protein Name phosphoinositide-3-kinase, catalytic, beta polypeptide
RefSeq NM_006219.1
Length of RefSeq (bp) 3213
Chromosome 3q22.3
Reference DDBJ accession
UniGene Hs.239818

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd33G03 pGCAP10 GGGCGGCGGCGCGCGCGTGCTCTGTCGGCCTGTGCGGCGCTGCGGCGGAGCGGGCCATGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl