Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07790

HP ID(1) HP07790
Gene ID(2) 8460
Gene Symbol finder TPST1
Protein Name tyrosylprotein sulfotransferase 1
RefSeq NM_003596.2
Length of RefSeq (bp) 2033
Chromosome 7q11.21
Reference DDBJ accession
UniGene Hs.421194

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd32G11 pGCAP10 GGAGTTGGCGACCGCGGGAGACGCTGCTGAGGCGGCTTCGGTTGCGGGTCGGAACGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl