Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07786

HP ID(1) HP07786
Gene ID(2) 5082
Gene Symbol finder PDCL
Protein Name phosducin-like
RefSeq NM_005388.3
Length of RefSeq (bp) 2774
Chromosome 9q12-q13
Reference DDBJ accession
UniGene Hs.271749

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd32E02 pGCAP10 GACTGCTCTTCCTCTTAAGAAAGTGCTCCATTCCTTCCGGCGCCCGGAGCTGCTGGCCCA
RBd46G08 pGCAP10 GGGCTTTTCTCTTTAGCGCTCAGGGCGCTGACCCACTGCTCTTCCTCTTAAGAAAGTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl