Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07779

HP ID(1) HP07779
Gene ID(2) 57578
Gene Symbol finder KIAA1409
Protein Name KIAA1409
RefSeq NM_020818.3
Length of RefSeq (bp) 8471
Chromosome 14q32.13
Reference DDBJ accession
UniGene Hs.126561

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd31C06 pGCAP10 GGCGCCCCAGCGCCTCCCGCGGCGGCTTGGCCCCAGCCCCGGCGCCCCCACGCCTAAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl