Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07777

HP ID(1) HP07777
Gene ID(2) 122553
Gene Symbol finder TRAPPC6B
Protein Name trafficking protein particle complex 6B
RefSeq NM_177452.3
Length of RefSeq (bp) 3280
Chromosome 14q21.1
Reference DDBJ accession
UniGene Hs.13303

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd31A05 pGCAP10 GATCTCAGCTGGTTGGCTTTGGTTAGAGCTCCCGTCAGACTTTCGTTCGGCCCTAGGATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl