Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07765

HP ID(1) HP07765
Gene ID(2) 9424
Gene Symbol finder KCNK6
Protein Name potassium channel, subfamily K, member 6
RefSeq NM_004823.1
Length of RefSeq (bp) 2671
Chromosome 19q13.1
Reference DDBJ accession
UniGene Hs.240395

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi01F08 pGCAP10 GGGGGCATCTGCTGCCGCGCCTGTAGCACTCCCGGAACTGGAACTAGGTGCCAGACGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl