Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07753

HP ID(1) HP07753
Gene ID(2) 5565
Gene Symbol finder PRKAB2
Protein Name protein kinase, AMP-activated, beta 2 non-catalytic subunit?
RefSeq NM_005399.3
Length of RefSeq (bp) 5431
Chromosome 1q21.1
Reference DDBJ accession
UniGene Hs.50732

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi39C02 pGCAP10 GAGTGGCCCTTGGAGGAGGGAGCGCATCGCCCGAGGTGGTCCCCGACGAGCTGCAGCCAT
RBd30D11 pGCAP10 GATCACATCAGTGGCCCTTGGAGGAGGGAGCGCATCGCCCGAGGTGGTCCCCGACGAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl