Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07745

HP ID(1) HP07745
Gene ID(2) 4856
Gene Symbol finder NOV
Protein Name nephroblastoma overexpressed gene
RefSeq NM_002514.3
Length of RefSeq (bp) 2601
Chromosome 8q24.1
Reference DDBJ accession
UniGene Hs.235935

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi38B02 pGCAP10 GAAGCACCGGACCAGGGGGAAGGCGAGCAGTGCCAATCTACAGCGAAGAAAGTCTCGTTT
ARi38B05 pGCAP10 GACCGGACCAGGGGGAAGGCGAGCAGTGCCAATCTACAGCGAAGAAAGTCTCGTTTGGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl