Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07742

HP ID(1) HP07742
Gene ID(2) 257194
Gene Symbol finder NEGR1
Protein Name neuronal growth regulator 1
RefSeq NM_173808.2
Length of RefSeq (bp) 5669
Chromosome 1p31.1
Reference DDBJ accession
UniGene Hs.146542

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi37A09 pGCAP10 GACACTCCGGACGCGGCCAAAAGCAACCGAGAGGAGGTGTAGTGTGGTGCCAGGGGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl