Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07722

HP ID(1) HP07722
Gene ID(2) 51199
Gene Symbol finder NIN
Protein Name ninein (GSK3B interacting protein)
RefSeq NM_182944.2
Length of RefSeq (bp) 6808
Chromosome 14q22.1
Reference DDBJ accession
UniGene Hs.310429

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi34G03 pGCAP10 GGGCCCTTCCTCCCCGGCGTCCAGAGCTCCGGGTGGCCGCGGCCGAGCCGGGAGCCGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl