Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07683

HP ID(1) HP07683
Gene ID(2) 7172
Gene Symbol finder TPMT
Protein Name thiopurine S-methyltransferase
RefSeq NM_000367.2
Length of RefSeq (bp) 3258
Chromosome 6p22.3
Reference DDBJ accession
UniGene Hs.444319

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi70B04 pGCAP10 GGGGGCGCGGAGAAGTGGCGGAGGTGGAAGCGGAGGCGTACCCGCCCCTGGGGACGTCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl