Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07682

HP ID(1) HP07682
Gene ID(2) 23376
Gene Symbol finder KIAA0776
Protein Name KIAA0776
RefSeq NM_015323.4
Length of RefSeq (bp) 4219
Chromosome 6q16.1
Reference DDBJ accession
UniGene Hs.149367

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi69H10 pGCAP10 TCTGCGAGTCAGGCCGTGATGGCGGACGCCTGGGAAGAGATTAGGCGGTTGGCGGCCGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl