Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07677

HP ID(1) HP07677
Gene ID(2) 6894
Gene Symbol finder TARBP1?
Protein Name Tar (HIV-1) RNA binding protein 1
RefSeq NM_005646.3
Length of RefSeq (bp) 5130
Chromosome 1q42.3
Reference DDBJ accession
UniGene Hs.498115

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi69B01 pGCAP10 GATCGCACACGCCGGCGCCTTCCTTTGGGAGCCCGGGCCGGTGGCGCGGGCGCTCGGCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl